ORK10435

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10435

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10435
Clone name	pf02762
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SLC25A22
cDNA sequence	DNA sequence (1256 bp) Predicted protein sequence (323 aa)
HaloTag ORF Clone	FHC10435
Flexi ORF Clone	FXC10435
Description	Mitochondrial glutamate carrier 1 (GC-1)(Glutamate/H(+) symporter 1)(Solute carrier family 25 member 22)

Features of the cloned cDNA sequence

Description

Length: 1256 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	276 bp
Genome contig ID	gi51511727r_681639
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCTAGCCCCTGCCCCAATCCTGCCCTGGCCTGAA
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CACCCCCAGGGACAGAGCTGGTCTCTGGGCTGGGGGCCCCCGGGCCTGGG

Features of the protein sequence

Description

Length: 323 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9H936	2.3e-129	100.0	Mitochondrial g...	Homo sapiens
XP_001087788	1.9e-128	98.7	similar to mito...	Macaca mulatta
Q5RD81	3.5e-128	98.7	Mitochondrial g...	Pongo abelii
Q9D6M3	1.3e-124	95.6	Mitochondrial g...	Mus musculus
EDM12050	6.8e-124	94.7	rCG47744, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002067	11	24	PR00926	Mitochondrial carrier protein
	IPR002067	24	38	PR00926	Mitochondrial carrier protein
	IPR002113	46	67	PR00927	Adenine nucleotide translocator 1
	IPR002067	68	88	PR00926	Mitochondrial carrier protein
	IPR002113	79	91	PR00927	Adenine nucleotide translocator 1
	IPR002067	187	205	PR00926	Mitochondrial carrier protein
	IPR002067	232	254	PR00926	Mitochondrial carrier protein
	IPR002113	279	294	PR00927	Adenine nucleotide translocator 1
HMMPfam	IPR001993	7	98	PF00153	Mitochondrial substrate carrier
	IPR001993	102	219	PF00153	Mitochondrial substrate carrier
	IPR001993	224	306	PF00153	Mitochondrial substrate carrier
ProfileScan	IPR001993	6	93	PS50920	Mitochondrial substrate carrier
	IPR001993	101	214	PS50920	Mitochondrial substrate carrier
	IPR001993	223	312	PS50920	Mitochondrial substrate carrier

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	9	PAKLINGGIAGLIGVTCVFPIDL	31	SECONDARY	23
SOSUI2	2	294	VIAPLFGIAQVVYFLGIAESLLG	316	PRIMARY	23