Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10433
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10433
Clone name pf03711
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FRY
cDNA sequence DNA sequence (6783 bp)
Predicted protein sequence (1875 aa)
Description Protein furry homolog
Features of the cloned cDNA sequence

Length: 6783 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1153 bp
Genome contig ID gi51511729f_31558517
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TTAATTGATATTCTGTTCAGAACTTTCTTTAGACT
Flanking genome sequence
(210235 - 210284)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGACAAAATACACGTTGACCATGGACTTTATTTCTG

Features of the protein sequence

Length: 1875 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_488539 0 94.6 similar to furr...
 Mus musculus
XP_981437 0 94.6 similar to furr...
 Mus musculus
AAI72205 0 99.4 furry homolog [...
 synthetic construct
Q5TBA9 0 99.4 Protein furry h...
 Homo sapiens
XP_001493939 0 97.1 furry homolog (...
 Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR006203 602 612 PS00627 GHMP kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp