Length: 7350 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
4812 bp |
Genome contig ID |
gi51511724f_42951183 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- AAGAACGGTTTTGTAATAAAATTATAGCTGTATCT |
Flanking genome sequence (108899 - 108948) |
----+----*----+----*----+----*----+----*----+----* AAAAACAATGCCATAGAAGTTTGATTTTTTAATAGCATTGAACTATATAT |
Length: 69 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92926 |
9e-29 |
100.0 |
farnesyltransfe...
|
Homo sapiens
|
AAB61714 |
2.6e-05 |
72.2 |
putative transp...
|
Homo sapiens
|
XP_535991 |
3.9e-05 |
58.3 |
similar to tigg...
|
Canis lupus fam...
|
XP_875830 |
0.00021 |
66.6 |
similar to puta...
|
Bos taurus
|
EAW85970 |
0.00025 |
49.0 |
hCG2041958 [Hom...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.