Length: 6540 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
3226 bp |
Genome contig ID |
gi51511734f_17863207 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- CAGCCTGGGTGACAGACAGAGCGAGACTCCATCTC |
Flanking genome sequence (106542 - 106591) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAGAATGGTGGATGCCAGAGGCAGA |
Length: 1103 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92660 |
0 |
100.0 |
myosin XV varia...
|
Homo sapiens
|
EAW55665 |
0 |
99.8 |
myosin XVA, iso...
|
Homo sapiens
|
NP_057323 |
0 |
99.8 |
myosin XV [Homo...
|
Homo sapiens
|
EAW55663 |
0 |
99.8 |
myosin XVA, iso...
|
Homo sapiens
|
EAW55666 |
0 |
99.8 |
myosin XVA, iso...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.