Length: 5447 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
611 bp |
Genome contig ID |
gi89161205r_50253515 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- AAACACGGGTATCTCCGCGTGGTGCTTTGCGGTCG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* CCGTCGTTGTGGCCGTCCGGGGTGGGGTGTGAGGAGGGGACGAAGGAGGG |
Length: 254 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92858 |
5.9e-96 |
100.0 |
zinc finger, MY...
|
Homo sapiens
|
AAB67311 |
6.8e-08 |
95.5 |
match to W07770...
|
Homo sapiens
|
XP_001168867 |
7.4e-08 |
47.6 |
zinc finger, MY...
|
Pan troglodytes
|
XP_001168913 |
7.5e-08 |
47.6 |
zinc finger, MY...
|
Pan troglodytes
|
AAC24728 |
8.6e-08 |
47.6 |
BLu protein tes...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.