Length: 5592 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
322 bp |
Genome contig ID |
gi89161205f_37955728 |
PolyA signal sequence (GATAAA,-22) |
+----*----+----*----+----*----+---- CCACAGCCACTAAGATAAATTCATGCACTTTTACT |
Flanking genome sequence (183503 - 183552) |
----+----*----+----*----+----*----+----*----+----* ATGCCCATTGCACTTCTCATCCATGGATTTGCCTTGCCTTAAGAATTAAC |
Length: 1755 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAG11659 |
0 |
100.0 |
deleted in lung...
|
Homo sapiens
|
NP_031361 |
0 |
99.8 |
deleted in lung...
|
Homo sapiens
|
Q9Y238 |
0 |
99.7 |
Deleted in lung...
|
Homo sapiens
|
NP_031363 |
0 |
99.8 |
deleted in lung...
|
Homo sapiens
|
XP_001488976 |
0 |
80.2 |
deleted in lung...
|
Equus caballus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.