Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00046
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00046
Clone name eg01752
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MAST4
cDNA sequence DNA sequence (7527 bp)
Predicted protein sequence (2366 aa)
Flexi ORF Clone FXC00046
Description Microtubule-associated serine/threonine-protein kinase 4 (EC 2.7.11.1).
Features of the cloned cDNA sequence

Length: 7527 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 213 bp
Genome contig ID gi51511721f_66236354
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TAACCGGTAAAACTGTTACCAGATAGTGTTTGTAC
Flanking genome sequence
(262496 - 262545)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAAATTACCTTTACAGTTGAGGGTT

Features of the protein sequence

Length: 2366 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11161 0 100.0 microtubule-ass...
 synthetic construct
EAW51320 0 97.2 similar to micr...
 Homo sapiens
AAW52510 0 97.0 serine/threonin...
 Homo sapiens
O15021 0 97.0 Microtubule-ass...
 Homo sapiens
NP_055998 0 97.0 microtubule-ass...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 380 653 PD000001 Protein kinase
HMMPfam IPR015022 66 342 PF08926 Domain of unknown function DUF1908
IPR000719 380 653 PF00069 Protein kinase
IPR000961 671 717 PF00433 Protein kinase
IPR001478 919 969 PF00595 PDZ/DHR/GLGF
HMMSmart IPR001245 380 653 SM00219 Tyrosine protein kinase
IPR002290 380 653 SM00220 Serine/threonine protein kinase
IPR001478 892 972 SM00228 PDZ/DHR/GLGF
ProfileScan IPR000719 380 653 PS50011 Protein kinase
IPR001478 884 972 PS50106 PDZ/DHR/GLGF
ScanRegExp IPR008271 499 511 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp