Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00050
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00050
Clone name hg00426s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZFYVE26
cDNA sequence DNA sequence (9658 bp)
Predicted protein sequence (2552 aa)
Flexi ORF Clone FXC00050
Description zinc finger, FYVE domain containing 26
Features of the cloned cDNA sequence

Length: 9658 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1911 bp
Genome contig ID gi51511730r_67182995
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TACTACAAACAAGCCACAATAAAGTGTCTATCAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTTTCTTGGCTTCATAACTTCTTGGTGCTGTCTTGCTCCTACCCTTTG

Features of the protein sequence

Length: 2552 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11658 0 100.0 FYVE domain con...
Homo sapiens
BAG72892 0 100.0 zinc finger, FY...
synthetic construct
EAW80953 0 99.9 zinc finger, FY...
Homo sapiens
AAI72413 0 99.8 Zinc finger, FY...
synthetic construct
Q68DK2 0 99.8 Zinc finger FYV...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000306 1820 1886 PF01363 Zinc finger
HMMSmart IPR000306 1817 1886 SM00064 Zinc finger
ProfileScan IPR000306 1825 1885 PS50178 Zinc finger
ScanRegExp IPR007087 1576 1600 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp