ORK00084

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00084

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00084
Clone name	fj13896
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DSTYK
cDNA sequence	DNA sequence (3614 bp) Predicted protein sequence (980 aa)
HaloTag ORF Clone	FHC00084
Flexi ORF Clone	FXC00084
Description	Receptor-interacting serine/threonine-protein kinase 5 (EC 2.7.11.1) (Dusty protein kinase) (Dusty PK) (RIP-homologous kinase) (Sugen kinase 496).

Features of the cloned cDNA sequence

Description

Length: 3614 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	670 bp
Genome contig ID	gi89161185r_203282639
PolyA signal sequence (None)	+--------+--------+----*----+---- TCACTGTTACATCACCAAGAGGCCCTGAAAAGAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAGGCCAGGCATGGTGGCTCACGCCTGTAATCTCA

Features of the protein sequence

Description

Length: 980 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6XUX3	100.0	Dual serine/thr...	Homo sapiens
AAH72406	99.8	Dual serine/thr...	Homo sapiens
EAW91542	99.8	receptor intera...	Homo sapiens
Q4VSN5	99.5	Dual serine/thr...	Pan troglodytes
NP_001035038	98.4	receptor intera...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	768	948	PD000001	Protein kinase
HMMPfam	IPR000719	703	948	PF00069	Protein kinase
HMMSmart	IPR001245	703	957	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	703	957	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	703	957	PS50011	Protein kinase
ScanRegExp	IPR000719	709	732	PS00107	Protein kinase
ScanRegExp	IPR008271	824	836	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	877	DNSVDVYAFGILFWYICSGSVKL	899	PRIMARY	23