Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00110
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00110
Clone name pf02026s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CLASP1
cDNA sequence DNA sequence (7815 bp)
Predicted protein sequence (1473 aa)
Flexi ORF Clone FXC00110
Description cytoplasmic linker associated protein 1
Features of the cloned cDNA sequence

Length: 7815 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3083 bp
Genome contig ID gi89161199r_121711824
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTGAGTTTGCCCTAGAATAAATGAGACTTAATTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTTCTGCTTGATGATGTCTTTACCACCACCATGCCCTGCAGACAGCT

Features of the protein sequence

Length: 1473 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10364 0 100.0 CLIP-associatin...
synthetic construct
AAI12941 0 99.3 CLASP1 protein ...
Homo sapiens
XP_001504123 0 97.3 cytoplasmic lin...
Equus caballus
NP_083985 0 96.7 CLIP-associatin...
Mus musculus
AAH94432 0 96.6 Clasp1 protein ...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 172 208 PF02985 HEAT
IPR000357 449 485 PF02985 HEAT
IPR000357 1276 1312 PF02985 HEAT
IPR000357 1395 1430 PF02985 HEAT
ProfileScan IPR000357 178 216 PS50077 HEAT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp