Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00131
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00131
Clone name ej00810
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol VPS8
cDNA sequence DNA sequence (4958 bp)
Predicted protein sequence (1433 aa)
Flexi ORF Clone FXC00131
Description Vacuolar protein sorting-associated protein 8 homolog.
Features of the cloned cDNA sequence

Length: 4958 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 579 bp
Genome contig ID gi89161205f_185925025
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CCCTTTCTAACAATAAATGCTCTGTGTTTAAGTTC
Flanking genome sequence
(328063 - 328112)
----+----*----+----*----+----*----+----*----+----*
TGCAGGTCTCCTGGCTGGCTGGCTCTCAGTCTGTCAAGTCATGGAGGACA

Features of the protein sequence

Length: 1433 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10385 0 100.0 vacuolar protei...
synthetic construct
BAF85112 0 99.8 unnamed protein...
Homo sapiens
Q8N3P4 0 99.7 Vacuolar protei...
Homo sapiens
NP_001009921 0 99.7 vacuolar protei...
Homo sapiens
XP_001097106 0 98.9 similar to CG10...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 1263 1296 PF00097 Zinc finger
HMMSmart IPR001841 1263 1314 SM00184 Zinc finger
ProfileScan IPR001680 200 241 PS50082 WD40 repeat
IPR001680 200 241 PS50294 WD40 repeat
IPR001841 1263 1315 PS50089 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp