Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00138
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00138
Clone name hk06136s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZC3H13
cDNA sequence DNA sequence (6806 bp)
Predicted protein sequence (1670 aa)
Flexi ORF Clone FXC00138
Description zinc finger CCCH-type containing 13
Features of the cloned cDNA sequence

Length: 6806 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1457 bp
Genome contig ID gi51511729r_45327819
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
TTACTAAGTGTTTTGAATAAAGAAAAAAAAAATGT
Flanking genome sequence
(99987 - 99938)		 
----+----*----+----*----+----*----+----*----+----*
ATGACCTCAGAGAATGAATACCCTTCAGGAAGCCACTTCCTGATTTTAGT

Features of the protein sequence

Length: 1670 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5T200 0 99.9 Zinc finger CCC...
 Homo sapiens
CAM13064 0 99.8 zinc finger CCC...
 Homo sapiens
CAB66679 0 99.9 hypothetical pr...
 Homo sapiens
XP_612879 0 90.3 zinc finger CCC...
 Bos taurus
XP_001927376 0 90.3 similar to mCG1...
 Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000571 39 65 PF00642 Zinc finger
HMMSmart IPR000571 38 65 SM00356 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp