Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00179
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00179
Clone name ee11614
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PITRM1
cDNA sequence DNA sequence (3411 bp)
Predicted protein sequence (1035 aa)
Flexi ORF Clone FXC00179
Description Presequence protease, mitochondrial precursor (EC 3.4.24.-) (hPreP) (Pitrilysin metalloproteinase 1) (Metalloprotease 1) (hMP1).
Features of the cloned cDNA sequence

Length: 3411 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 301 bp
Genome contig ID gi89161187r_3069922
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTAAGAATCTAAAAATAAAGGGCAACTCTGACTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCTCTGCTTGAGTCATTATTTTAAGCAGCATTTAGGGCCTTTATTTAA

Features of the protein sequence

Length: 1035 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5JRX3 0 100.0 Presequence pro...
Homo sapiens
AAH05025 0 99.8 Pitrilysin meta...
Homo sapiens
EAW86490 0 99.8 pitrilysin meta...
Homo sapiens
NP_055704 0 99.7 presequence pro...
Homo sapiens
AAH95422 0 99.7 Pitrilysin meta...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007863 242 430 PF05193 Peptidase M16
IPR013578 502 750 PF08367 Peptidase M16C associated
IPR007863 758 957 PF05193 Peptidase M16
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp