ORK00180

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00180

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00180
Clone name	eh00729
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SCAF8
cDNA sequence	DNA sequence (4949 bp) Predicted protein sequence (1330 aa)
HaloTag ORF Clone	FHC00180
Flexi ORF Clone	FXC00180
Description	Putative RNA-binding protein 16 (RNA-binding motif protein 16).

Features of the cloned cDNA sequence

Description

Length: 4949 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	663 bp
Genome contig ID	gi89161210f_154996257
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTTTTTAGATGCCAATAAAACTTATTTGTTTGAT
Flanking genome sequence (200629 - 200678)	----+--------+--------+--------+--------+----* AACAGTGTTCTAGGAATTGTATTTTTTTAACCTATAAATTCTTAAAACCT

Features of the protein sequence

Description

Length: 1330 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_527544	99.4	RNA-binding mot...	Pan troglodytes
BAG10422	100.0	RNA binding mot...	synthetic construct
Q9UPN6	99.9	Putative RNA-bi...	Homo sapiens
AAH70071	99.8	RBM16 protein [...	Homo sapiens
XP_533458	96.1	similar to Puta...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006903	115	183	PF04818	Protein of unknown function DUF618
HMMPfam	IPR000504	538	605	PF00076	RNA recognition motif
HMMSmart	IPR006569	65	195	SM00582	Regulation of nuclear pre-mRNA protein
HMMSmart	IPR000504	537	606	SM00360	RNA recognition motif
ProfileScan	IPR000504	536	610	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp