ORK00202

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00202

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00202
Clone name	fh06860s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PPFIBP1
cDNA sequence	DNA sequence (6025 bp) Predicted protein sequence (1024 aa)
HaloTag ORF Clone	FHC00202
Flexi ORF Clone	FXC00202
Description	PTPRF interacting protein, binding protein 1 (liprin beta 1)

Features of the cloned cDNA sequence

Description

Length: 6025 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2682 bp
Genome contig ID	gi89161190f_27468382
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TATGAAAGGAAATAAAGTCAATTGATAATTGCCTC
Flanking genome sequence (271383 - 271432)	----+--------+--------+--------+--------+----* ATTTTTATTGCCCTTATTTCATTTTCCGTTGTTCATAGTAACAGGCTTTG

Features of the protein sequence

Description

Length: 1024 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH50281	100.0	PPFIBP1 protein...	Homo sapiens
Q86W92	99.9	Liprin-beta-1; ...	Homo sapiens
XP_001363898	85.8	similar to PTPR...	Monodelphis dom...
EAW96558	100.0	PTPRF interacti...	Homo sapiens
BAG57559	99.4	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	658	722	PF00536	Sterile alpha motif SAM
	IPR001660	730	793	PF00536	Sterile alpha motif SAM
	IPR011510	817	889	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	657	724	SM00454	Sterile alpha motif SAM
	IPR001660	729	795	SM00454	Sterile alpha motif SAM
	IPR001660	817	889	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	660	724	PS50105	Sterile alpha motif SAM
ProfileScan	IPR001660	732	795	PS50105	Sterile alpha motif SAM

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp