ORK00210

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00210

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00210
Clone name	fj02793
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KCNH3
cDNA sequence	DNA sequence (3832 bp) Predicted protein sequence (1117 aa)
HaloTag ORF Clone	FHC00210
Flexi ORF Clone	FXC00210
Description	Potassium voltage-gated channel subfamily H member 3 (Voltage-gated potassium channel subunit Kv12.2) (Ether-a-go-go-like potassium channel 2) (ELK channel 2) (ELK2) (Brain-specific eag-like channel 1) (BEC1).

Features of the cloned cDNA sequence

Description

Length: 3832 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	326 bp
Genome contig ID	gi89161190f_48119213
PolyA signal sequence (ATTAAA,-6)	+--------+--------+----*----+---- CCTGCCTCTACCTGTCCCCAAATTTTTATATTAAA
Flanking genome sequence (119118 - 119167)	----+--------+--------+--------+--------+----* AAAAAAAAATAAAATAAACTACTTTGGAACCTGGTGCTTTTTATTTACAA

Features of the protein sequence

Description

Length: 1117 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD8	100.0	Potassium volta...	Homo sapiens
EAW58074	99.9	potassium volta...	Homo sapiens
XP_509046	99.7	potassium volta...	Pan troglodytes
XP_001109598	99.4	potassium volta...	Macaca mulatta
XP_001504252	96.4	similar to Pota...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003950	135	144	PR01465	ELK potassium channel
	IPR003950	148	156	PR01465	ELK potassium channel
	IPR003938	253	262	PR01463	EAG/ELK/ERG potassium channel
	IPR003938	271	278	PR01463	EAG/ELK/ERG potassium channel
	IPR003938	299	309	PR01463	EAG/ELK/ERG potassium channel
	IPR003938	310	319	PR01463	EAG/ELK/ERG potassium channel
	IPR003950	320	332	PR01465	ELK potassium channel
	IPR003950	387	395	PR01465	ELK potassium channel
	IPR003938	403	413	PR01463	EAG/ELK/ERG potassium channel
	IPR003938	486	503	PR01463	EAG/ELK/ERG potassium channel
	IPR003938	512	523	PR01463	EAG/ELK/ERG potassium channel
	IPR003950	523	530	PR01465	ELK potassium channel
	IPR003938	530	539	PR01463	EAG/ELK/ERG potassium channel
	IPR003938	580	587	PR01463	EAG/ELK/ERG potassium channel
	IPR003950	641	651	PR01465	ELK potassium channel
	IPR003938	696	704	PR01463	EAG/ELK/ERG potassium channel
HMMPfam	IPR013655	76	170	PF08447	PAS fold-3
	IPR005821	297	534	PF00520	Ion transport
	IPR000595	634	721	PF00027	Cyclic nucleotide-binding
HMMSmart	IPR001610	128	170	SM00086	PAC motif
HMMSmart	IPR000595	616	731	SM00100	Cyclic nucleotide-binding
HMMTigr	IPR000014	50	177	TIGR00229	PAS
ProfileScan	IPR000014	76	124	PS50112	PAS
	IPR000700	127	179	PS50113	PAS-associated
	IPR000595	616	680	PS50042	Cyclic nucleotide-binding

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	263	GFILLATLYVAVTVPYSVCVSTA	285	PRIMARY	23
	2	337	VTTWFLLDVIAALPFDLLHAFKV	359	PRIMARY	23
	3	391	AVVLTLLMAVFALLAHWVACVWF	413	PRIMARY	23