ORK00215

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00215

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00215
Clone name	fh15405s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FBXO42
cDNA sequence	DNA sequence (6290 bp) Predicted protein sequence (750 aa)
HaloTag ORF Clone	FHC00215
Flexi ORF Clone	FXC00215
Description	F-box protein 42

Features of the cloned cDNA sequence

Description

Length: 6290 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3831 bp
Genome contig ID	gi89161185r_16345921
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCAATTTAACAAATAAAATGGACAATTGTCTTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTTTTATTAGCAAAAAAAGAAAAAGAAAAGAGGTCTGGCCGGGCGCAGT

Features of the protein sequence

Description

Length: 750 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6P3S6	100.0	F-box only prot...	Homo sapiens
BAG51542	99.8	unnamed protein...	Homo sapiens
AAH43410	99.8	F-box protein 4...	Homo sapiens
Q5RDA9	99.3	F-box only prot...	Pongo abelii
XP_001086461	99.1	F-box protein 4...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001810	78	126	PF00646	Cyclin-like F-box
	IPR011498	151	201	PF07646	Kelch repeat type 2
	IPR006652	206	260	PF01344	Kelch repeat type 1
	IPR011498	264	310	PF07646	Kelch repeat type 2
HMMSmart	IPR001810	83	123	SM00256	Cyclin-like F-box
ProfileScan	IPR001810	77	126	PS50181	Cyclin-like F-box

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp