Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00241
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00241
Clone name fj09513s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CNTN3
cDNA sequence DNA sequence (4928 bp)
Predicted protein sequence (1031 aa)
Flexi ORF Clone FXC00241
Description contactin 3 (plasmacytoma associated)
Features of the cloned cDNA sequence

Length: 4928 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1830 bp
Genome contig ID gi89161205r_74294412
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TATTATTTTCTATTCTAATAAAATTTATAACAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGAGTGTGCAGTATTAATTGCGGTATGGTCAAAGAAGAATGTCTACA

Features of the protein sequence

Length: 1031 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10467 0 100.0 contactin-3 pre...
synthetic construct
AAI50609 0 99.9 Contactin 3 (pl...
Homo sapiens
Q9P232 0 99.8 Contactin-3; Br...
Homo sapiens
XP_526232 0 99.7 contactin 3 iso...
Pan troglodytes
XP_001143126 0 99.5 contactin 3 iso...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013151 46 105 PF00047 Immunoglobulin
IPR013151 140 201 PF00047 Immunoglobulin
IPR013098 230 317 PF07679 Immunoglobulin I-set
IPR013098 321 406 PF07679 Immunoglobulin I-set
IPR013098 411 499 PF07679 Immunoglobulin I-set
IPR013151 517 582 PF00047 Immunoglobulin
IPR003961 601 690 PF00041 Fibronectin
IPR003961 703 793 PF00041 Fibronectin
IPR003961 805 894 PF00041 Fibronectin
IPR003961 906 989 PF00041 Fibronectin
HMMSmart IPR003599 38 122 SM00409 Immunoglobulin subtype
IPR003598 44 110 SM00408 Immunoglobulin subtype 2
IPR003599 132 220 SM00409 Immunoglobulin subtype
IPR003598 138 206 SM00408 Immunoglobulin subtype 2
IPR003599 237 318 SM00409 Immunoglobulin subtype
IPR003598 243 307 SM00408 Immunoglobulin subtype 2
IPR003599 327 407 SM00409 Immunoglobulin subtype
IPR003598 333 396 SM00408 Immunoglobulin subtype 2
IPR003599 419 500 SM00409 Immunoglobulin subtype
IPR003598 425 489 SM00408 Immunoglobulin subtype 2
IPR003599 509 598 SM00409 Immunoglobulin subtype
IPR003598 515 587 SM00408 Immunoglobulin subtype 2
IPR003961 601 687 SM00060 Fibronectin
IPR003961 704 790 SM00060 Fibronectin
IPR003961 806 891 SM00060 Fibronectin
IPR003961 906 986 SM00060 Fibronectin
ProfileScan IPR007110 29 120 PS50835 Immunoglobulin-like
IPR007110 125 211 PS50835 Immunoglobulin-like
IPR007110 230 316 PS50835 Immunoglobulin-like
IPR007110 321 405 PS50835 Immunoglobulin-like
IPR007110 411 500 PS50835 Immunoglobulin-like
IPR007110 502 596 PS50835 Immunoglobulin-like
IPR003961 601 696 PS50853 Fibronectin
IPR003961 703 801 PS50853 Fibronectin
IPR003961 805 901 PS50853 Fibronectin
IPR003961 906 995 PS50853 Fibronectin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp