ORK00245

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00245

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00245
Clone name	ee00796
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	GRAMD1A
cDNA sequence	DNA sequence (2878 bp) Predicted protein sequence (739 aa)
HaloTag ORF Clone	FHC00245
Flexi ORF Clone	FXC00245
Description	GRAM domain-containing protein 1A.

Features of the cloned cDNA sequence

Description

Length: 2878 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	328 bp
Genome contig ID	gi42406306f_40083088
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGGGCCGACAGTGCCCCAATAAAGGGTCAGAAGTG
Flanking genome sequence (126127 - 126176)	----+--------+--------+--------+--------+----* GCTGTGGCTGTGCCTGTGGGGCCCTGGGAGTGGGTGGGAGCCTCCTGTTG

Features of the protein sequence

Description

Length: 739 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10472	100.0	GRAM domain-con...	synthetic construct
Q96CP6	99.1	GRAM domain-con...	Homo sapiens
BAG53435	99.7	unnamed protein...	Homo sapiens
XP_524216	99.1	GRAM domain con...	Pan troglodytes
BAC11289	98.4	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004182	110	177	PF02893	GRAM
HMMSmart	IPR004182	110	177	SM00568	GRAM

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	623	IPSALVLISIVLIILIALNVLLF	645	PRIMARY	23