Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00268
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00268
Clone name fh23820
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SENP7
cDNA sequence DNA sequence (4679 bp)
Predicted protein sequence (1040 aa)
Flexi ORF Clone FXC00268
Description Sentrin-specific protease 7 (EC 3.4.22.-) (Sentrin/SUMO-specific protease SENP7) (SUMO-1-specific protease 2).
Features of the cloned cDNA sequence

Length: 4679 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1556 bp
Genome contig ID gi89161205r_102425810
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TCAGTGTTTTATATTAAACATATTTCCAATTCATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTGAGGTGTAATTTTTTTCCTTAAGAAACATGAGCTACTGTTAGAAA

Features of the protein sequence

Length: 1040 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_065705 0 99.5 sentrin-specifi...
Homo sapiens
AAI29989 0 99.4 SUMO1/sentrin s...
Homo sapiens
EAW79801 0 99.4 SUMO1/sentrin s...
Homo sapiens
BAG10482 0 100.0 sentrin-specifi...
synthetic construct
EAW79798 0 99.9 SUMO1/sentrin s...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003653 750 1026 PF02902 Peptidase C48
ProfileScan IPR003653 750 993 PS50600 Peptidase C48
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp