Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00281
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00281
Clone name bm02415
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PHYHIPL
cDNA sequence DNA sequence (1914 bp)
Predicted protein sequence (452 aa)
Flexi ORF Clone FXC00281
Description phytanoyl-CoA 2-hydroxylase interacting protein-like
Features of the cloned cDNA sequence

Length: 1914 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 555 bp
Genome contig ID gi89161187f_60506392
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACTGTGTTTCAACATAATAAATATAATAGAAAAAT
Flanking genome sequence
(169522 - 169571)
----+----*----+----*----+----*----+----*----+----*
ATTTTATTTGTATTGTTGTATAAAATATTTACAATCATATAGAATATATA

Features of the protein sequence

Length: 452 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96FC7 1e-145 100.0 Phytanoyl-CoA h...
Homo sapiens
NP_115815 1.8e-145 99.7 phytanoyl-CoA h...
Homo sapiens
AAY18942 2.8e-145 100.0 DKFZp761M0113 [...
synthetic construct
XP_536357 1.4e-144 98.9 similar to phyt...
Canis lupus fam...
Q32L96 1.2e-143 98.4 Phytanoyl-CoA h...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003961 126 222 PF00041 Fibronectin
ProfileScan IPR003961 125 230 PS50853 Fibronectin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp