Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00292
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00292
Clone name eg00383
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ARMC9
cDNA sequence DNA sequence (2191 bp)
Predicted protein sequence (668 aa)
Flexi ORF Clone FXC00292
Description LisH domain-containing protein ARMC9 (Melanoma/melanocyte specific protein KU-MEL-1) (NS21).
Features of the cloned cDNA sequence

Length: 2191 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 107 bp
Genome contig ID gi89161199f_231671612
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTAAAATTCAAAATAAAGCATTCATTTTGAAAAGC
Flanking genome sequence
(246547 - 246596)
----+----*----+----*----+----*----+----*----+----*
ATTTATCTCTTTATTTTTGGGGGATTTTTGGAGGGAAAGAGGTTGAGTCC

Features of the protein sequence

Length: 668 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAD97923 0 100.0 hypothetical pr...
Homo sapiens
EAW70954 0 100.0 armadillo repea...
Homo sapiens
AAH65271 0 99.8 Armadillo repea...
Homo sapiens
AAO63554 0 99.8 ARM protein [Ho...
Homo sapiens
Q7Z3E5 0 99.8 LisH domain-con...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR006594 10 42 SM00667 LisH dimerisation motif
ProfileScan IPR006594 10 42 PS50896 LisH dimerisation motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp