ORK00305

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00305

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00305
Clone name	ee02696
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CCBE1
cDNA sequence	DNA sequence (3453 bp) Predicted protein sequence (467 aa)
HaloTag ORF Clone	FHC00305
Flexi ORF Clone	FXC00305
Description	Collagen and calcium-binding EGF domain-containing protein 1 precursor.

Features of the cloned cDNA sequence

Description

Length: 3453 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1991 bp
Genome contig ID	gi51511735r_55152400
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAGCCTAGGCAACAGAGGGAGACTCTGTCTCATT
Flanking genome sequence (99729 - 99680)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAGGCCGGGCTTGGTGGCTCATGCCTG

Features of the protein sequence

Description

Length: 467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_512156	6.9e-149	98.6	collagen and ca...	Pan troglodytes
XP_001090495	1.6e-145	97.5	similar to coll...	Macaca mulatta
Q6UXH8	3e-134	100.0	Collagen and ca...	Homo sapiens
EDL09670	2.5e-124	87.1	collagen and ca...	Mus musculus
EDL09671	2e-123	89.2	collagen and ca...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013091	195	235	PF07645	EGF calcium-binding
	IPR008160	306	351	PF01391	Collagen triple helix repeat
	IPR008160	361	394	PF01391	Collagen triple helix repeat
HMMSmart	IPR001881	150	194	SM00179	EGF-like calcium-binding
	IPR006210	153	194	SM00181	EGF
	IPR001881	195	236	SM00179	EGF-like calcium-binding
	IPR006210	198	236	SM00181	EGF
ProfileScan	IPR000742	195	236	PS50026	EGF-like
ScanRegExp	IPR001881	195	220	PS01187	EGF-like calcium-binding
	IPR000152	211	222	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	220	235	PS01186	EGF-like region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp