ORK00313

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00313

Order Kazusa clone(s) from :

Accession No	AB290169
Product ID	ORK00313
Clone name	ah04445y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYH14
cDNA sequence	DNA sequence (6883 bp) Predicted protein sequence (2041 aa)
HaloTag ORF Clone	FHC00313
Flexi ORF Clone	FXC00313
Description	Myosin-14 (Myosin heavy chain 14) (Myosin heavy chain, nonmuscle IIc) (Nonmuscle myosin heavy chain IIc) (NMHC II-C).

Features of the cloned cDNA sequence

Description

Length: 6883 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	755 bp
Genome contig ID	gi42406306f_55305431
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CTGGCAGAAATAAACTCCAACCCGACTGGACCATC
Flanking genome sequence (200185 - 200234)	----+--------+--------+--------+--------+----* TCTGTGGCTGTGTGTGTTCCTGCAGGGGGTCTCTGATGGGGCAGGATGGG

Features of the protein sequence

Description

Length: 2041 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06723	100.0	MYH14 variant p...	Homo sapiens
XP_887804	94.7	similar to myos...	Bos taurus
ABR10605	91.5	nonmuscle myosi...	Mus musculus
XP_860825	66.6	similar to myos...	Canis lupus fam...
XP_001166222	67.5	myosin, heavy p...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	248	283	PD000355	Myosin head
FPrintScan	IPR001609	140	159	PR00193	Myosin head
	IPR001609	196	221	PR00193	Myosin head
	IPR001609	256	283	PR00193	Myosin head
	IPR001609	486	514	PR00193	Myosin head
	IPR001609	540	568	PR00193	Myosin head
HMMPfam	IPR004009	58	100	PF02736	Myosin
	IPR001609	112	834	PF00063	Myosin head
	IPR000048	850	870	PF00612	IQ calmodulin-binding region
	IPR002928	1136	1993	PF01576	Myosin tail
HMMSmart	IPR001609	104	847	SM00242	Myosin head
HMMSmart	IPR000048	848	870	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	850	878	PS50096	IQ calmodulin-binding region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp