ORK00316

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00316

Order Kazusa clone(s) from :

Accession No	AB210003
Product ID	ORK00316
Clone name	fg01237
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	AKAP12
cDNA sequence	DNA sequence (6584 bp) Predicted protein sequence (1791 aa)
HaloTag ORF Clone	FHC00316
Flexi ORF Clone	FXC00316
Description	A-kinase anchor protein 12 (A-kinase anchor protein 250 kDa) (AKAP 250) (Myasthenia gravis autoantigen gravin).

Features of the cloned cDNA sequence

Description

Length: 6584 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1059 bp
Genome contig ID	gi89161210f_151503218
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGACGACTGATTTAAATAAAATATTTGCTTCACTT
Flanking genome sequence (216385 - 216434)	----+--------+--------+--------+--------+----* AGATTTGCTGGTTTTATTAGATACCAGGAAGCCTGGGACATATGTGTACC

Features of the protein sequence

Description

Length: 1791 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06085	100.0	AKAP12 variant ...	Homo sapiens
BAG10526	100.0	A-kinase anchor...	synthetic construct
EAW47755	99.8	A kinase (PRKA)...	Homo sapiens
Q02952	99.7	A-kinase anchor...	Homo sapiens
CAI16151	99.7	A kinase (PRKA)...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001573	612	642	PF03832	Protein kinase A anchoring region
	IPR001573	761	791	PF03832	Protein kinase A anchoring region
	IPR001573	806	836	PF03832	Protein kinase A anchoring region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp