Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00319
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210038
Product ID ORK00319
Clone name pf00008
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TNC
cDNA sequence DNA sequence (7524 bp)
Predicted protein sequence (2233 aa)
Flexi ORF Clone FXC00319
Description Tenascin precursor (TN) (Tenascin-C) (TN-C) (Hexabrachion) (Cytotactin) (Neuronectin) (GMEM) (JI) (Myotendinous antigen) (Glioma- associated-extracellular matrix antigen) (GP 150-225).
Features of the cloned cDNA sequence

Length: 7524 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 630 bp
Genome contig ID gi89161216r_116722627
PolyA signal sequence
(AATAAA,-30)		 
+----*----+----*----+----*----+----
TTTTAAATAAAAGCACAAGTACTTTTGAGTTTGTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATTTTGCTTTGAATTGTTGAGTCTGAATTTCACCAAAGCCAATCATTTGA

Features of the protein sequence

Length: 2233 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06120 0 100.0 TNC variant pro...
 Homo sapiens
BAG10537 0 100.0 tenascin precur...
 synthetic construct
EAW87434 0 99.8 tenascin C (hex...
 Homo sapiens
CAI15110 0 99.8 tenascin C [Hom...
 Homo sapiens
P24821 0 99.7 Tenascin; Short...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013111 222 248 PF07974 EGF
IPR013111 253 279 PF07974 EGF
IPR013111 284 311 PF07974 EGF
IPR006209 316 342 PF00008 EGF-like
IPR013111 347 373 PF07974 EGF
IPR013111 378 404 PF07974 EGF
IPR013111 409 435 PF07974 EGF
IPR013111 440 466 PF07974 EGF
IPR013111 471 497 PF07974 EGF
IPR013111 502 528 PF07974 EGF
IPR013111 533 559 PF07974 EGF
IPR013111 564 590 PF07974 EGF
IPR006209 595 621 PF00008 EGF-like
IPR013111 626 652 PF07974 EGF
IPR003961 655 733 PF00041 Fibronectin
IPR003961 744 825 PF00041 Fibronectin
IPR003961 835 914 PF00041 Fibronectin
IPR003961 925 1006 PF00041 Fibronectin
IPR003961 1017 1094 PF00041 Fibronectin
IPR003961 1106 1185 PF00041 Fibronectin
IPR003961 1197 1275 PF00041 Fibronectin
IPR003961 1288 1367 PF00041 Fibronectin
IPR003961 1379 1458 PF00041 Fibronectin
IPR003961 1470 1540 PF00041 Fibronectin
IPR003961 1561 1640 PF00041 Fibronectin
IPR003961 1652 1731 PF00041 Fibronectin
IPR003961 1742 1820 PF00041 Fibronectin
IPR003961 1831 1908 PF00041 Fibronectin
IPR003961 1919 1996 PF00041 Fibronectin
IPR002181 2012 2221 PF00147 Fibrinogen
HMMSmart IPR006210 221 249 SM00181 EGF
IPR006210 252 280 SM00181 EGF
IPR006210 283 312 SM00181 EGF
IPR006210 315 343 SM00181 EGF
IPR006210 346 374 SM00181 EGF
IPR006210 377 405 SM00181 EGF
IPR006210 408 436 SM00181 EGF
IPR006210 439 467 SM00181 EGF
IPR006210 470 498 SM00181 EGF
IPR006210 501 529 SM00181 EGF
IPR006210 532 560 SM00181 EGF
IPR006210 563 591 SM00181 EGF
IPR006210 594 622 SM00181 EGF
IPR006210 625 653 SM00181 EGF
IPR003961 655 735 SM00060 Fibronectin
IPR003961 744 826 SM00060 Fibronectin
IPR003961 835 914 SM00060 Fibronectin
IPR003961 925 1006 SM00060 Fibronectin
IPR003961 1017 1094 SM00060 Fibronectin
IPR003961 1106 1184 SM00060 Fibronectin
IPR003961 1197 1277 SM00060 Fibronectin
IPR003961 1288 1366 SM00060 Fibronectin
IPR003961 1379 1457 SM00060 Fibronectin
IPR003961 1470 1550 SM00060 Fibronectin
IPR003961 1561 1640 SM00060 Fibronectin
IPR003961 1652 1731 SM00060 Fibronectin
IPR003961 1742 1820 SM00060 Fibronectin
IPR003961 1831 1908 SM00060 Fibronectin
IPR003961 1919 1996 SM00060 Fibronectin
IPR002181 2011 2221 SM00186 Fibrinogen
ProfileScan IPR000742 218 249 PS50026 EGF-like
IPR000742 312 343 PS50026 EGF-like
IPR000742 405 436 PS50026 EGF-like
IPR000742 498 529 PS50026 EGF-like
IPR000742 591 622 PS50026 EGF-like
IPR003961 654 742 PS50853 Fibronectin
IPR003961 745 833 PS50853 Fibronectin
IPR003961 834 923 PS50853 Fibronectin
IPR003961 924 1015 PS50853 Fibronectin
IPR003961 1016 1103 PS50853 Fibronectin
IPR003961 1107 1194 PS50853 Fibronectin
IPR003961 1196 1285 PS50853 Fibronectin
IPR003961 1287 1376 PS50853 Fibronectin
IPR003961 1380 1467 PS50853 Fibronectin
IPR003961 1471 1558 PS50853 Fibronectin
IPR003961 1560 1649 PS50853 Fibronectin
IPR003961 1651 1740 PS50853 Fibronectin
IPR003961 1741 1829 PS50853 Fibronectin
IPR003961 1830 1917 PS50853 Fibronectin
IPR003961 1918 2005 PS50853 Fibronectin
ScanRegExp IPR013032 206 217 PS00022 EGF-like region
IPR013032 206 217 PS01186 EGF-like region
IPR013032 237 248 PS00022 EGF-like region
IPR013032 237 248 PS01186 EGF-like region
IPR013032 268 279 PS00022 EGF-like region
IPR013032 268 279 PS01186 EGF-like region
IPR013032 300 311 PS00022 EGF-like region
IPR013032 300 311 PS01186 EGF-like region
IPR013032 331 342 PS00022 EGF-like region
IPR013032 331 342 PS01186 EGF-like region
IPR013032 362 373 PS00022 EGF-like region
IPR013032 362 373 PS01186 EGF-like region
IPR013032 393 404 PS00022 EGF-like region
IPR013032 393 404 PS01186 EGF-like region
IPR013032 424 435 PS00022 EGF-like region
IPR013032 424 435 PS01186 EGF-like region
IPR013032 455 466 PS00022 EGF-like region
IPR013032 455 466 PS01186 EGF-like region
IPR013032 486 497 PS00022 EGF-like region
IPR013032 486 497 PS01186 EGF-like region
IPR013032 517 528 PS00022 EGF-like region
IPR013032 517 528 PS01186 EGF-like region
IPR013032 548 559 PS00022 EGF-like region
IPR013032 548 559 PS01186 EGF-like region
IPR013032 579 590 PS00022 EGF-like region
IPR013032 579 590 PS01186 EGF-like region
IPR013032 610 621 PS00022 EGF-like region
IPR013032 610 621 PS01186 EGF-like region
IPR013032 641 652 PS00022 EGF-like region
IPR013032 641 652 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp