ORK00321

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00321

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00321
Clone name	hh01357
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CNTNAP1
cDNA sequence	DNA sequence (5513 bp) Predicted protein sequence (1458 aa)
HaloTag ORF Clone	FHC00321
Flexi ORF Clone	FXC00321
Description	Contactin-associated protein 1 precursor (Caspr) (Caspr1) (Neurexin 4) (Neurexin IV) (p190).

Features of the cloned cDNA sequence

Description

Length: 5513 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1076 bp
Genome contig ID	gi51511734f_37988251
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGACGCGGAGCCGTTCCAATAAAGCAGAGTGGCAG
Flanking genome sequence (117281 - 117330)	----+--------+--------+--------+--------+----* AGCCCCAGTCTGTGTGTGGTAGCTGGCGTCGTGGTTAGGGGATAAGTGGG

Features of the protein sequence

Description

Length: 1458 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10552	100.0	contactin-assoc...	synthetic construct
P78357	99.9	Contactin-assoc...	Homo sapiens
EAW60869	99.8	contactin assoc...	Homo sapiens
XP_001111174	98.9	contactin assoc...	Macaca mulatta
XP_001493608	96.1	similar to Cont...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000421	111	239	PF00754	Coagulation factor 5/8 type
	IPR012680	277	406	PF02210	Laminin G
	IPR012680	463	589	PF02210	Laminin G
	IPR006209	618	650	PF00008	EGF-like
	IPR002181	654	691	PF00147	Fibrinogen
	IPR012680	887	1013	PF02210	Laminin G
	IPR006209	1035	1069	PF00008	EGF-like
	IPR012680	1162	1292	PF02210	Laminin G
HMMSmart	IPR000421	98	242	SM00231	Coagulation factor 5/8 type
	IPR001791	269	406	SM00282	Laminin G
	IPR001791	455	589	SM00282	Laminin G
	IPR001791	879	1013	SM00282	Laminin G
	IPR001791	1154	1292	SM00282	Laminin G
	IPR003585	1378	1396	SM00294	Neurexin/syndecan/glycophorin C
ProfileScan	IPR000421	99	242	PS50022	Coagulation factor 5/8 type
	IPR001791	248	429	PS50025	Laminin G
	IPR001791	435	612	PS50025	Laminin G
	IPR000742	614	651	PS50026	EGF-like
	IPR001791	859	1031	PS50025	Laminin G
	IPR000742	1032	1070	PS50026	EGF-like
	IPR001791	1123	1324	PS50025	Laminin G
ScanRegExp	IPR000421	134	163	PS01285	Coagulation factor 5/8 type
ScanRegExp	IPR000421	224	242	PS01286	Coagulation factor 5/8 type

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1356	VAILLGFLVAFLLLGLVGMLVLF	1378	PRIMARY	23