ORK00330

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00330

Order Kazusa clone(s) from :

Accession No	AB209045
Product ID	ORK00330
Clone name	hh02438
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	COL5A2
cDNA sequence	DNA sequence (6192 bp) Predicted protein sequence (1502 aa)
HaloTag ORF Clone	FHC00330
Flexi ORF Clone	FXC00330
Description	Collagen alpha-2(V) chain precursor.

Features of the cloned cDNA sequence

Description

Length: 6192 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1555 bp
Genome contig ID	gi89161199r_189505486
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- AAAGCATCAAATTAAATGCACGCTTTTGTCATGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGGTTTTTGTTTTGTGAAATTCCTTTGACCATATTAGATCTATTTCAT

Features of the protein sequence

Description

Length: 1502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92282	100.0	alpha 2 type V ...	Homo sapiens
P05997	100.0	Collagen alpha-...	Homo sapiens
XP_001164152	99.8	alpha 2 type V ...	Pan troglodytes
XP_001163952	99.7	alpha 2 type V ...	Pan troglodytes
EAX10906	99.7	collagen, type ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	274	300	PD000007	Collagen helix repeat
	IPR008161	382	403	PD000007	Collagen helix repeat
	IPR008161	529	558	PD000007	Collagen helix repeat
	IPR008161	561	592	PD000007	Collagen helix repeat
	IPR008161	765	792	PD000007	Collagen helix repeat
	IPR008161	864	894	PD000007	Collagen helix repeat
	IPR008161	997	1027	PD000007	Collagen helix repeat
	IPR008161	1068	1085	PD000007	Collagen helix repeat
	IPR000885	1390	1502	PD002078	Fibrillar collagen
HMMPfam	IPR001007	44	99	PF00093	von Willebrand factor
	IPR008160	129	188	PF01391	Collagen triple helix repeat
	IPR008160	215	269	PF01391	Collagen triple helix repeat
	IPR008160	273	332	PF01391	Collagen triple helix repeat
	IPR008160	333	392	PF01391	Collagen triple helix repeat
	IPR008160	393	452	PF01391	Collagen triple helix repeat
	IPR008160	453	512	PF01391	Collagen triple helix repeat
	IPR008160	513	572	PF01391	Collagen triple helix repeat
	IPR008160	573	632	PF01391	Collagen triple helix repeat
	IPR008160	633	692	PF01391	Collagen triple helix repeat
	IPR008160	693	752	PF01391	Collagen triple helix repeat
	IPR008160	753	812	PF01391	Collagen triple helix repeat
	IPR008160	816	875	PF01391	Collagen triple helix repeat
	IPR008160	876	935	PF01391	Collagen triple helix repeat
	IPR008160	936	995	PF01391	Collagen triple helix repeat
	IPR008160	1044	1103	PF01391	Collagen triple helix repeat
	IPR008160	1116	1175	PF01391	Collagen triple helix repeat
	IPR008160	1176	1235	PF01391	Collagen triple helix repeat
	IPR000885	1285	1501	PF01410	Fibrillar collagen
HMMSmart	IPR001007	44	99	SM00214	von Willebrand factor
HMMSmart	IPR000885	1268	1502	SM00038	Fibrillar collagen
ProfileScan	IPR001007	42	100	PS50184	von Willebrand factor
ScanRegExp	IPR001007	62	99	PS01208	von Willebrand factor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	NWAEARPLLILIVLLGQFVSIK	28	PRIMARY	22