ORK00331

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00331

Order Kazusa clone(s) from :

Accession No	AB209136
Product ID	ORK00331
Clone name	fg03766
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DSCAM
cDNA sequence	DNA sequence (6694 bp) Predicted protein sequence (2023 aa)
HaloTag ORF Clone	FHC00331
Flexi ORF Clone	FXC00331
Description	Down syndrome cell adhesion molecule precursor (CHD2).

Features of the cloned cDNA sequence

Description

Length: 6694 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	620 bp
Genome contig ID	gi51511750r_40206211
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TAAGCGAAATAAAAAAGAAAAGGTTGTCTGCCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCCATGTCTGCTTCTCTCGTCTTCTGCCAGTGGCCTGGTCCTCCTTC

Features of the protein sequence

Description

Length: 2023 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92373	100.0	Down syndrome c...	Homo sapiens
BAG10715	100.0	down syndrome c...	synthetic construct
O60469	99.9	Down syndrome c...	Homo sapiens
XP_001171521	99.7	Down syndrome c...	Pan troglodytes
XP_001491675	98.2	similar to Down...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	236	321	PF07679	Immunoglobulin I-set
	IPR013151	339	398	PF00047	Immunoglobulin
	IPR013098	418	512	PF07679	Immunoglobulin I-set
	IPR013151	529	588	PF00047	Immunoglobulin
	IPR013098	607	697	PF07679	Immunoglobulin I-set
	IPR013098	701	795	PF07679	Immunoglobulin I-set
	IPR013151	813	878	PF00047	Immunoglobulin
	IPR003961	896	983	PF00041	Fibronectin
	IPR003961	995	1087	PF00041	Fibronectin
	IPR003961	1099	1188	PF00041	Fibronectin
	IPR003961	1200	1284	PF00041	Fibronectin
	IPR013098	1297	1387	PF07679	Immunoglobulin I-set
	IPR003961	1391	1474	PF00041	Fibronectin
HMMSmart	IPR003598	48	120	SM00408	Immunoglobulin subtype 2
	IPR003599	141	229	SM00409	Immunoglobulin subtype
	IPR003599	242	322	SM00409	Immunoglobulin subtype
	IPR003598	248	311	SM00408	Immunoglobulin subtype 2
	IPR003596	252	306	SM00406	Immunoglobulin V-set
	IPR003599	331	414	SM00409	Immunoglobulin subtype
	IPR003598	337	403	SM00408	Immunoglobulin subtype 2
	IPR003599	424	513	SM00409	Immunoglobulin subtype
	IPR003598	430	502	SM00408	Immunoglobulin subtype 2
	IPR003599	521	605	SM00409	Immunoglobulin subtype
	IPR003598	527	593	SM00408	Immunoglobulin subtype 2
	IPR003599	613	698	SM00409	Immunoglobulin subtype
	IPR003598	619	687	SM00408	Immunoglobulin subtype 2
	IPR003599	707	796	SM00409	Immunoglobulin subtype
	IPR003598	713	784	SM00408	Immunoglobulin subtype 2
	IPR003596	717	779	SM00406	Immunoglobulin V-set
	IPR003599	805	894	SM00409	Immunoglobulin subtype
	IPR003598	811	883	SM00408	Immunoglobulin subtype 2
	IPR003961	896	980	SM00060	Fibronectin
	IPR003961	996	1084	SM00060	Fibronectin
	IPR003961	1099	1185	SM00060	Fibronectin
	IPR003961	1200	1281	SM00060	Fibronectin
	IPR003599	1303	1388	SM00409	Immunoglobulin subtype
	IPR003598	1312	1377	SM00408	Immunoglobulin subtype 2
	IPR003596	1313	1372	SM00406	Immunoglobulin V-set
	IPR003961	1391	1471	SM00060	Fibronectin
	IPR003961	1488	1568	SM00060	Fibronectin
ProfileScan	IPR007110	136	227	PS50835	Immunoglobulin-like
	IPR007110	236	316	PS50835	Immunoglobulin-like
	IPR007110	324	412	PS50835	Immunoglobulin-like
	IPR007110	418	511	PS50835	Immunoglobulin-like
	IPR007110	515	603	PS50835	Immunoglobulin-like
	IPR007110	607	696	PS50835	Immunoglobulin-like
	IPR007110	701	794	PS50835	Immunoglobulin-like
	IPR007110	798	894	PS50835	Immunoglobulin-like
	IPR003961	896	989	PS50853	Fibronectin
	IPR003961	995	1093	PS50853	Fibronectin
	IPR003961	1099	1194	PS50853	Fibronectin
	IPR003961	1200	1290	PS50853	Fibronectin
	IPR007110	1296	1388	PS50835	Immunoglobulin-like
	IPR003961	1387	1481	PS50853	Fibronectin
	IPR003961	1487	1577	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1605	KMLVTISCILVGVLLLFVLLLVV	1627	PRIMARY	23