ORK00332

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00332

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00332
Clone name	fj05942
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	COL3A1
cDNA sequence	DNA sequence (4818 bp) Predicted protein sequence (1469 aa)
HaloTag ORF Clone	FHC00332
Flexi ORF Clone	FXC00332
Description	Collagen alpha-1(III) chain precursor.

Features of the cloned cDNA sequence

Description

Length: 4818 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	279 bp
Genome contig ID	gi89161199f_189447323
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGCTATAATAAATAAACTTCAACACTCTTTATGAT
Flanking genome sequence (137703 - 137752)	----+--------+--------+--------+--------+----* AACAACACTGTGTTATATTCTTTGAATCCTAGCCCATCTGCAGAGCAATG

Features of the protein sequence

Description

Length: 1469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAA32583	100.0	prepro-alpha-1 ...	Homo sapiens
P02461	99.9	Collagen alpha-...	Homo sapiens
XP_001163292	100.0	similar to COL3...	Pan troglodytes
XP_851009	93.0	similar to Coll...	Canis lupus fam...
XP_863148	92.9	similar to Coll...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	460	478	PD000007	Collagen helix repeat
	IPR008161	1013	1039	PD000007	Collagen helix repeat
	IPR000885	1369	1469	PD002078	Fibrillar collagen
HMMPfam	IPR001007	35	91	PF00093	von Willebrand factor
	IPR008160	105	142	PF01391	Collagen triple helix repeat
	IPR008160	171	230	PF01391	Collagen triple helix repeat
	IPR008160	237	296	PF01391	Collagen triple helix repeat
	IPR008160	297	356	PF01391	Collagen triple helix repeat
	IPR008160	357	416	PF01391	Collagen triple helix repeat
	IPR008160	417	476	PF01391	Collagen triple helix repeat
	IPR008160	477	536	PF01391	Collagen triple helix repeat
	IPR008160	537	596	PF01391	Collagen triple helix repeat
	IPR008160	597	656	PF01391	Collagen triple helix repeat
	IPR008160	657	716	PF01391	Collagen triple helix repeat
	IPR008160	717	776	PF01391	Collagen triple helix repeat
	IPR008160	780	839	PF01391	Collagen triple helix repeat
	IPR008160	840	899	PF01391	Collagen triple helix repeat
	IPR008160	900	959	PF01391	Collagen triple helix repeat
	IPR008160	960	1019	PF01391	Collagen triple helix repeat
	IPR008160	1020	1079	PF01391	Collagen triple helix repeat
	IPR008160	1080	1139	PF01391	Collagen triple helix repeat
	IPR008160	1140	1199	PF01391	Collagen triple helix repeat
	IPR000885	1251	1468	PF01410	Fibrillar collagen
HMMSmart	IPR001007	35	91	SM00214	von Willebrand factor
HMMSmart	IPR000885	1234	1469	SM00038	Fibrillar collagen
ProfileScan	IPR001007	33	92	PS50184	von Willebrand factor
ScanRegExp	IPR001007	53	91	PS01208	von Willebrand factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp