ORK00336

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00336

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00336
Clone name	ah03865
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	COL4A5
cDNA sequence	DNA sequence (6457 bp) Predicted protein sequence (1693 aa)
Flexi ORF Clone	FXC00336
Description	Collagen alpha-5(IV) chain precursor.

Features of the cloned cDNA sequence

Description

Length: 6457 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1161 bp
Genome contig ID	gi89161218f_107469817
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CCACCAATATAAATTTAATTAAAGATATATGTTGT
Flanking genome sequence (357610 - 357659)	----+--------+--------+--------+--------+----* AAGGATGGTCTGTTGTGTATCTCTTCAGCCTGTGTGGAAAAAACCCCTGC

Features of the protein sequence

Description

Length: 1693 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P29400	100.0	Collagen alpha-...	Homo sapiens
NP_203700	99.8	type IV collage...	Homo sapiens
EAX02684	99.7	collagen, type ...	Homo sapiens
AAF66217	99.6	type IV collage...	Homo sapiens
AAI51847	99.4	Collagen, type ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	314	338	PD000007	Collagen helix repeat
	IPR008161	643	677	PD000007	Collagen helix repeat
	IPR008161	1318	1338	PD000007	Collagen helix repeat
	IPR001442	1474	1578	PD003923	Type 4 procollagen
	IPR001442	1584	1693	PD003923	Type 4 procollagen
HMMPfam	IPR008160	50	94	PF01391	Collagen triple helix repeat
	IPR008160	110	169	PF01391	Collagen triple helix repeat
	IPR008160	175	226	PF01391	Collagen triple helix repeat
	IPR008160	266	290	PF01391	Collagen triple helix repeat
	IPR008160	294	353	PF01391	Collagen triple helix repeat
	IPR008160	364	399	PF01391	Collagen triple helix repeat
	IPR008160	427	451	PF01391	Collagen triple helix repeat
	IPR008160	460	487	PF01391	Collagen triple helix repeat
	IPR008160	499	558	PF01391	Collagen triple helix repeat
	IPR008160	572	631	PF01391	Collagen triple helix repeat
	IPR008160	669	713	PF01391	Collagen triple helix repeat
	IPR008160	715	762	PF01391	Collagen triple helix repeat
	IPR008160	763	821	PF01391	Collagen triple helix repeat
	IPR008160	827	862	PF01391	Collagen triple helix repeat
	IPR008160	895	954	PF01391	Collagen triple helix repeat
	IPR008160	1017	1076	PF01391	Collagen triple helix repeat
	IPR008160	1082	1141	PF01391	Collagen triple helix repeat
	IPR008160	1142	1196	PF01391	Collagen triple helix repeat
	IPR008160	1198	1254	PF01391	Collagen triple helix repeat
	IPR008160	1255	1313	PF01391	Collagen triple helix repeat
	IPR008160	1314	1373	PF01391	Collagen triple helix repeat
	IPR008160	1402	1461	PF01391	Collagen triple helix repeat
	IPR001442	1469	1578	PF01413	Type 4 procollagen
	IPR001442	1579	1692	PF01413	Type 4 procollagen
HMMSmart	IPR001442	1469	1578	SM00111	Type 4 procollagen
HMMSmart	IPR001442	1579	1692	SM00111	Type 4 procollagen
HMMTigr	IPR006311	4	34	TIGR01409	Twin-arginine translocation pathway signal

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	12	RGVSLAAGLFLLALSLWG	29	PRIMARY	18