Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00345
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00345
Clone name ej00450
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TCERG1
cDNA sequence DNA sequence (4111 bp)
Predicted protein sequence (1081 aa)
Flexi ORF Clone FXC00345
Description transcription elongation regulator 1
Features of the cloned cDNA sequence

Length: 4111 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 863 bp
Genome contig ID gi51511721f_145707092
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
ATGTATTTGAACTACAATAAACCAACCCTTTTTAT
Flanking genome sequence
(164171 - 164220)		 
----+----*----+----*----+----*----+----*----+----*
ATATCTGTATTGTATATGATTATTGTTACTTAATTTTTAAGAGCTTATTT

Features of the protein sequence

Length: 1081 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93147 0 100.0 transcription e...
 Homo sapiens
AAI11728 0 100.0 Transcription e...
 Homo sapiens
XP_001158244 0 99.4 transcription e...
 Pan troglodytes
XP_001101519 0 99.6 similar to tran...
 Macaca mulatta
EDL10030 0 97.5 mCG127945, isof...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001202 137 166 PF00397 WW/Rsp5/WWP
IPR001202 414 443 PF00397 WW/Rsp5/WWP
IPR001202 513 542 PF00397 WW/Rsp5/WWP
IPR002713 644 692 PF01846 FF
IPR002713 710 759 PF01846 FF
IPR002713 777 826 PF01846 FF
IPR002713 881 932 PF01846 FF
IPR002713 939 990 PF01846 FF
IPR002713 997 1057 PF01846 FF
HMMSmart IPR001202 136 168 SM00456 WW/Rsp5/WWP
IPR001202 413 445 SM00456 WW/Rsp5/WWP
IPR001202 512 544 SM00456 WW/Rsp5/WWP
IPR002713 642 695 SM00441 FF
IPR002713 708 762 SM00441 FF
IPR002713 775 829 SM00441 FF
IPR002713 879 935 SM00441 FF
IPR002713 937 993 SM00441 FF
IPR002713 995 1060 SM00441 FF
ProfileScan IPR001202 135 168 PS50020 WW/Rsp5/WWP
IPR001202 412 445 PS50020 WW/Rsp5/WWP
IPR001202 515 544 PS50020 WW/Rsp5/WWP
ScanRegExp IPR001202 418 443 PS01159 WW/Rsp5/WWP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp