Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00347
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00347
Clone name eg01033
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PIK3C2A
cDNA sequence DNA sequence (6693 bp)
Predicted protein sequence (1696 aa)
Flexi ORF Clone FXC00347
Description Phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing alpha polypeptide (EC 2.7.1.154) (Phosphoinositide 3-Kinase-C2-alpha) (PtdIns-3-kinase C2 alpha) (PI3K-C2alpha).
Features of the cloned cDNA sequence

Length: 6693 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1472 bp
Genome contig ID gi51511727r_16966665
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CTCCCGCCTGGGTGACAAGAGCAAAACTCCATCTT
Flanking genome sequence
(99724 - 99675)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAAAGAGTAAGATTCATTTTTATTAGTTACTCAACTT

Features of the protein sequence

Length: 1696 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O00443 0 100.0 Phosphatidylino...
 Homo sapiens
XP_001172532 0 99.5 phosphoinositid...
 Pan troglodytes
CAA73797 0 99.5 phosphoinositid...
 Homo sapiens
Q5RAY1 0 98.6 Phosphatidylino...
 Pongo abelii
XP_542517 0 93.4 similar to phos...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000008 1598 1610 PR00360 C2 calcium-dependent membrane targeting
IPR000008 1627 1640 PR00360 C2 calcium-dependent membrane targeting
HMMPfam IPR000341 419 522 PF00794 Phosphoinositide 3-kinase
IPR002420 713 853 PF00792 Phosphoinositide 3-kinase
IPR001263 872 1058 PF00613 Phosphoinositide 3-kinase accessory region PIK
IPR000403 1142 1357 PF00454 Phosphatidylinositol 3- and 4-kinase
IPR001683 1432 1544 PF00787 Phox-like
IPR000008 1584 1672 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR000341 419 522 SM00144 Phosphoinositide 3-kinase
IPR002420 684 793 SM00142 Phosphoinositide 3-kinase
IPR000008 695 817 SM00239 C2 calcium-dependent membrane targeting
IPR001263 871 1058 SM00145 Phosphoinositide 3-kinase accessory region PIK
IPR000403 1144 1406 SM00146 Phosphatidylinositol 3- and 4-kinase
IPR001683 1432 1544 SM00312 Phox-like
IPR000008 1583 1687 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR000403 1143 1407 PS50290 Phosphatidylinositol 3- and 4-kinase
IPR001683 1432 1548 PS50195 Phox-like
IPR000008 1583 1672 PS50004 C2 calcium-dependent membrane targeting
ScanRegExp IPR000403 1147 1161 PS00915 Phosphatidylinositol 3- and 4-kinase
IPR000403 1245 1265 PS00916 Phosphatidylinositol 3- and 4-kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp