ORK00351

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00351

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00351
Clone name	af03823
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone af03823 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	PLXNA1
cDNA sequence	DNA sequence (7515 bp) Predicted protein sequence (1985 aa)
HaloTag ORF Clone	FHC00351
Flexi ORF Clone	FXC00351
Description	Plexin-A1 precursor (Semaphorin receptor NOV).

Features of the cloned cDNA sequence

Description

Length: 7515 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1556 bp
Genome contig ID	gi89161205f_128090057
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTCTGAGTTGATCTTTTTAAAACTGCAAGTGTTG
Flanking genome sequence (147051 - 147100)	----+--------+--------+--------+--------+----* AATACTAGAGGTTGTTAGACCCTTTTTTATGTTTTTTAATTAATCAGTCA

Features of the protein sequence

Description

Length: 1985 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11034	100.0	plexin-A1 precu...	synthetic construct
EAW79351	100.0	plexin A1, isof...	Homo sapiens
Q9UIW2	99.7	Plexin-A1; Sema...	Homo sapiens
AAI56130	100.0	Plexin A1 [synt...	synthetic construct
XP_001114446	99.6	similar to plex...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	140	584	PF01403	Semaphorin/CD100 antigen
	IPR002165	603	653	PF01437	Plexin
	IPR002165	749	796	PF01437	Plexin
	IPR002165	897	951	PF01437	Plexin
	IPR002909	953	1047	PF01833	Cell surface receptor IPT/TIG
	IPR002909	1050	1133	PF01833	Cell surface receptor IPT/TIG
	IPR002909	1137	1235	PF01833	Cell surface receptor IPT/TIG
	IPR002909	1239	1324	PF01833	Cell surface receptor IPT/TIG
	IPR013548	1406	1955	PF08337	Plexin cytoplasmic region
HMMSmart	IPR001627	140	585	SM00630	Semaphorin/CD100 antigen
	IPR003659	603	653	SM00423	Plexin/semaphorin/integrin
	IPR003659	749	796	SM00423	Plexin/semaphorin/integrin
	IPR003659	897	951	SM00423	Plexin/semaphorin/integrin
	IPR002909	952	1048	SM00429	Cell surface receptor IPT/TIG
	IPR002909	1049	1134	SM00429	Cell surface receptor IPT/TIG
	IPR002909	1136	1236	SM00429	Cell surface receptor IPT/TIG
	IPR002909	1238	1333	SM00429	Cell surface receptor IPT/TIG
ProfileScan	IPR001627	114	601	PS51004	Semaphorin/CD100 antigen

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	93	PPRSLQVLLLLLLLLLLLPGMWA	115	PRIMARY	23
SOSUI2	2	1331	TLPAIVGIGGGGGLLLLVIVAVL	1353	PRIMARY	23