ORK00974

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00974

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00974
Clone name	aj00183
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CAPN15
cDNA sequence	DNA sequence (4448 bp) Predicted protein sequence (1109 aa)
HaloTag ORF Clone	FHC00974
Flexi ORF Clone	FXC00974
Description	Calpain-15 (EC 3.4.22.-) (Small optic lobes homolog).

Features of the cloned cDNA sequence

Description

Length: 4448 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1118 bp
Genome contig ID	gi51511732f_430326
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCTCCAATGGACCAAATAAAAGCGTTTTGTTTTGT
Flanking genome sequence (114311 - 114360)	----+--------+--------+--------+--------+----* AATCACGCCTCCTCCTCCTGCTGTTGCCCCGCGCAGGGCCCTGTGGAAGG

Features of the protein sequence

Description

Length: 1109 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75808	100.0	Calpain-15; Sma...	Homo sapiens
XP_001085465	97.2	similar to smal...	Macaca mulatta
EDM03986	87.3	small optic lob...	Rattus norvegicus
XP_547218	85.1	similar to smal...	Canis lupus fam...
Q9JLG8	87.3	Calpain-15; Sma...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001300	495	518	PR00704	Peptidase C2
	IPR001300	602	627	PR00704	Peptidase C2
	IPR001300	632	655	PR00704	Peptidase C2
	IPR001300	657	684	PR00704	Peptidase C2
	IPR001300	792	813	PR00704	Peptidase C2
HMMPfam	IPR001876	166	195	PF00641	Zinc finger
	IPR001876	435	464	PF00641	Zinc finger
	IPR001300	511	816	PF00648	Peptidase C2
HMMSmart	IPR001876	28	52	SM00547	Zinc finger
	IPR001876	69	93	SM00547	Zinc finger
	IPR001876	168	192	SM00547	Zinc finger
	IPR001876	365	389	SM00547	Zinc finger
	IPR001876	437	461	SM00547	Zinc finger
	IPR001300	492	824	SM00230	Peptidase C2
ProfileScan	IPR001876	26	55	PS50199	Zinc finger
	IPR001876	166	195	PS50199	Zinc finger
	IPR001876	361	392	PS50199	Zinc finger
	IPR001876	435	464	PS50199	Zinc finger
	IPR001300	510	816	PS50203	Peptidase C2
ScanRegExp	IPR001876	30	49	PS01358	Zinc finger
	IPR001876	71	90	PS01358	Zinc finger
	IPR001876	170	189	PS01358	Zinc finger
	IPR001876	367	386	PS01358	Zinc finger
	IPR001876	439	458	PS01358	Zinc finger
	IPR000169	569	580	PS00139	Peptidase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp