ORK00978

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00978

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00978
Clone name	bm03032
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ZNF622
cDNA sequence	DNA sequence (1702 bp) Predicted protein sequence (500 aa)
HaloTag ORF Clone	FHC00978
Flexi ORF Clone	FXC00978
Description	Zinc finger protein 622 (Zinc finger-like protein 9).

Features of the cloned cDNA sequence

Description

Length: 1702 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	158 bp
Genome contig ID	gi51511721r_16404629
PolyA signal sequence (CATAAA,-24)	+--------+--------+----*----+---- AAAGTTAGAACCATAAAAAAAAAAAAAAAAAAAAA
Flanking genome sequence (214256 - 214207)	----+--------+--------+--------+--------+----* GCCTCAGTGAAAGGTAGGGAACTTTCTTTCCGTGTTGTGCTTAATGGAGG

Features of the protein sequence

Description

Length: 500 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q969S3	1.3e-175	100.0	Zinc finger pro...	Homo sapiens
XP_001917283	2e-157	90.1	zinc finger pro...	Equus caballus
AAH88214	4.9e-150	87.2	Zinc finger pro...	Rattus norvegicus
AAI02395	1.9e-145	84.0	Zinc finger pro...	Bos taurus
Q91VY9	1.8e-142	81.7	Zinc finger pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003604	24	58	SM00451	Zinc finger
	IPR015880	27	51	SM00355	Zinc finger
	IPR003604	87	121	SM00451	Zinc finger
	IPR015880	90	114	SM00355	Zinc finger
	IPR015880	275	298	SM00355	Zinc finger
	IPR015880	326	353	SM00355	Zinc finger
ScanRegExp	IPR007087	29	51	PS00028	Zinc finger
ScanRegExp	IPR007087	92	114	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp