Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00979
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210000
Product ID ORK00979
Clone name eh00696
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TSC2
cDNA sequence DNA sequence (5421 bp)
Predicted protein sequence (1775 aa)
Flexi ORF Clone FXC00979
Description Tuberin (Tuberous sclerosis 2 protein).
Features of the cloned cDNA sequence

Length: 5421 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 92 bp
Genome contig ID gi51511732f_1937991
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ATAAAGTCCTGACCCCAGTGCACAGACATAGAGGC
Flanking genome sequence
(140715 - 140764)		 
----+----*----+----*----+----*----+----*----+----*
ACAGATTGCAGTCAGACAGCTCTTTTATTGACTTTGTCTGCTTGGTGCGG

Features of the protein sequence

Length: 1775 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06082 0 100.0 SLC9A3R2 varian...
 Homo sapiens
BAG10215 0 100.0 tuberin [synthe...
 synthetic construct
EDL22344 0 90.1 tuberous sclero...
 Mus musculus
XP_864967 0 90.8 similar to Tube...
 Canis lupus fam...
AAH52449 0 91.1 Tuberous sclero...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR003913 198 221 PR01431 Tuberin
IPR003913 244 263 PR01431 Tuberin
IPR003913 324 342 PR01431 Tuberin
IPR003913 387 407 PR01431 Tuberin
IPR003913 595 616 PR01431 Tuberin
IPR003913 637 662 PR01431 Tuberin
IPR003913 713 733 PR01431 Tuberin
IPR003913 738 759 PR01431 Tuberin
IPR003913 873 893 PR01431 Tuberin
IPR003913 919 939 PR01431 Tuberin
HMMPfam IPR003913 585 939 PF03542 Tuberin
IPR000331 1529 1712 PF02145 Rap/ran-GAP
ProfileScan IPR000331 1499 1726 PS50085 Rap/ran-GAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp