Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00980
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00980
Clone name fh09182
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol IER5
cDNA sequence DNA sequence (5403 bp)
Predicted protein sequence (362 aa)
Flexi ORF Clone FXC00980
Description Immediate early response gene 5 protein.
Features of the cloned cDNA sequence

Length: 5403 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4227 bp
Genome contig ID gi89161185f_179224470
PolyA signal sequence
(TATAAA,-19)
+----*----+----*----+----*----+----
GAATGAAATTAATAATTATAAAACTGTTCCATCTT
Flanking genome sequence
(105525 - 105574)
----+----*----+----*----+----*----+----*----+----*
ATCACTGGGTTAGTCTGAGTCTCTCTTACTGCAACTTACTAGGCATGATA

Features of the protein sequence

Length: 362 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAF44348 2.3e-99 100.0 hypothetical pr...
Homo sapiens
Q5VY09 4.3e-99 99.6 Immediate early...
Homo sapiens
EAW91099 4.8e-99 99.6 immediate early...
Homo sapiens
CAB91983 5.3e-99 99.6 hypothetical pr...
Homo sapiens
AAG23784 1.4e-98 99.3 PP4583 [Homo sa...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR008653 36 362 PF05760 Immediate early response
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp