ORK00984

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00984

Order Kazusa clone(s) from :

Accession No	AB210011
Product ID	ORK00984
Clone name	fh13310
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TNPO2
cDNA sequence	DNA sequence (4993 bp) Predicted protein sequence (1051 aa)
HaloTag ORF Clone	FHC00984
Flexi ORF Clone	FXC00984
Description	Transportin-2 (Karyopherin beta-2b).

Features of the cloned cDNA sequence

Description

Length: 4993 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1591 bp
Genome contig ID	gi42406306r_12571487
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGAAACTCGAGCAGGTCTCTGGAAGCCATTTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGTTTTAAAAATACCTTTTAATTTTCTGGTAATTC

Features of the protein sequence

Description

Length: 1051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06093	100.0	TNPO2 variant p...	Homo sapiens
XP_512411	99.9	transportin 2 (...	Pan troglodytes
XP_001109480	99.2	similar to tran...	Macaca mulatta
BAG10221	100.0	transportin-2 [...	synthetic construct
EDL10988	99.6	transportin 2 (...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001494	195	263	PF03810	Importin-beta
	IPR000357	286	321	PF02985	HEAT
	IPR000357	331	367	PF02985	HEAT
	IPR000357	373	408	PF02985	HEAT
	IPR000357	553	589	PF02985	HEAT
	IPR000357	594	630	PF02985	HEAT
	IPR000357	636	672	PF02985	HEAT
	IPR000357	823	859	PF02985	HEAT

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp