ORK00985

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00985

Order Kazusa clone(s) from :

Accession No	AB210012
Product ID	ORK00985
Clone name	fh15436
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DAB1
cDNA sequence	DNA sequence (5686 bp) Predicted protein sequence (559 aa)
HaloTag ORF Clone	FHC00985
Flexi ORF Clone	FXC00985
Description	Disabled homolog 1.

Features of the cloned cDNA sequence

Description

Length: 5686 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3362 bp
Genome contig ID	gi89161185r_57133043
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATGTAAAACTGTTACAAATAAACATGTTTGAGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACACTTTAGCCTGGCTTTATTCTACAAGTTTCCACTGGATATTCAGGCT

Features of the protein sequence

Description

Length: 559 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE06094	3.6e-171	100.0	DAB1 variant pr...	Homo sapiens
CAI19218	5.6e-170	100.0	disabled homolo...	Homo sapiens
EAX06638	7.8e-169	99.6	disabled homolo...	Homo sapiens
AAC70068	9.8e-169	99.2	disabled-1 [Hom...	Homo sapiens
Q9BGX5	1.5e-168	99.0	Disabled homolog 1.	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006020	46	172	PF00640	Phosphotyrosine interaction region
HMMSmart	IPR006020	41	175	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR006020	41	173	PS01179	Phosphotyrosine interaction region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp