ORK00993

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00993

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00993
Clone name	fj14744
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HSPA13
cDNA sequence	DNA sequence (3918 bp) Predicted protein sequence (472 aa)
HaloTag ORF Clone	FHC00993
Flexi ORF Clone	FXC00993
Description	Stress 70 protein chaperone microsome-associated 60 kDa protein precursor (Microsomal stress 70 protein ATPase core).

Features of the cloned cDNA sequence

Description

Length: 3918 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2499 bp
Genome contig ID	gi51511750r_14565310
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- AATGTAAATAAATACCATTTTGCAGTTTGTTTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTATGTACTTTTTCATTCAGGACTAGTCTGGAGTATACTTTTCAGGC

Features of the protein sequence

Description

Length: 472 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P48723	3.1e-188	100.0	Heat shock 70 k...	Homo sapiens
XP_531517	4.5e-188	99.7	hypothetical pr...	Pan troglodytes
AAH36370	1e-187	99.7	Heat shock prot...	Homo sapiens
BAD97002	1.6e-187	99.7	stress 70 prote...	Homo sapiens
Q5R8D9	3e-187	99.3	Heat shock 70 k...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013126	99	195	PD000089	Heat shock protein 70
FPrintScan	IPR001023	33	46	PR00301	Heat shock protein Hsp70
	IPR001023	63	75	PR00301	Heat shock protein Hsp70
	IPR001023	400	416	PR00301	Heat shock protein Hsp70
	IPR001023	431	451	PR00301	Heat shock protein Hsp70
HMMPfam	IPR013126	34	300	PF00012	Heat shock protein 70
HMMPfam	IPR013126	362	447	PF00012	Heat shock protein 70
ScanRegExp	IPR013126	37	44	PS00297	Heat shock protein 70
	IPR013126	224	237	PS00329	Heat shock protein 70
	IPR013126	403	417	PS01036	Heat shock protein 70

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	VMAREMTILGSAVLTLLLAGYLA	23	PRIMARY	23
SOSUI2	2	30	PTPKVIGIDLGTTYCSVGVFFPG	52	SECONDARY	23