ORK00999

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00999

Order Kazusa clone(s) from :

Accession No	AB210031
Product ID	ORK00999
Clone name	hh05718
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	C14orf159
cDNA sequence	DNA sequence (2638 bp) Predicted protein sequence (631 aa)
HaloTag ORF Clone	FHC00999
Flexi ORF Clone	FXC00999
Description	UPF0317 protein C14orf159, mitochondrial precursor.

Features of the cloned cDNA sequence

Description

Length: 2638 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	519 bp
Genome contig ID	gi51511730f_90550209
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAAAAATTTCAGAAATAAACAACTCTTAAGTTTT
Flanking genome sequence (211242 - 211291)	----+--------+--------+--------+--------+----* AAATTGTGTACTCTTCGGAATATCGTGATGAAATCTCACACCATCCTGCT

Features of the protein sequence

Description

Length: 631 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06113	100.0	C14orf159 varia...	Homo sapiens
BAG10237	100.0	chromosome 14 o...	synthetic construct
CAD61880	99.8	unnamed protein...	Homo sapiens
XP_510121	98.2	similar to C14o...	Pan troglodytes
BAG53908	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009906	127	270	PF07286	Protein of unknown function DUF1445

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp