Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01000
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210033
Product ID ORK01000
Clone name hj01659
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol IKBKAP
cDNA sequence DNA sequence (5224 bp)
Predicted protein sequence (1342 aa)
Flexi ORF Clone FXC01000
Description Elongator complex protein 1 (ELP1) (IkappaB kinase complex-associated protein) (IKK complex-associated protein) (p150).
Features of the cloned cDNA sequence

Length: 5224 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 939 bp
Genome contig ID gi89161216r_110570277
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
CCACTTCATTCTGATTAAAAATTCTTCCATGTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATATCAGAACCAGACCTTTCTTACTGTGTATCTTAGCCCATTTGTGTC

Features of the protein sequence

Length: 1342 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06115 0 100.0 IKBKAP variant ...
Homo sapiens
EAW59030 0 100.0 inhibitor of ka...
Homo sapiens
CAI39465 0 100.0 inhibitor of ka...
Homo sapiens
AAH33094 0 99.8 Inhibitor of ka...
Homo sapiens
AAG43369 0 99.9 IkappaBkinase c...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006849 11 964 PF04762 IKI3
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp