ORK01002

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01002

Order Kazusa clone(s) from :

Accession No	AB210035
Product ID	ORK01002
Clone name	hk02197
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk02197 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	ACLY
cDNA sequence	DNA sequence (4309 bp) Predicted protein sequence (1137 aa)
HaloTag ORF Clone	FHC01002
Flexi ORF Clone	FXC01002
Description	ATP-citrate synthase (EC 2.3.3.8) (ATP-citrate (pro-S-)-lyase) (Citrate cleavage enzyme).

Features of the cloned cDNA sequence

Description

Length: 4309 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	893 bp
Genome contig ID	gi51511734r_37176696
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- GGTTTAAATAAACTATATAGTAACAATGAAGGCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGCTGGCTCCTGGCATCCATATCCTTTGATCTGTATTCCTTTGTAACT

Features of the protein sequence

Description

Length: 1137 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06117	100.0	ACLY variant pr...	Homo sapiens
P53396	100.0	ATP-citrate syn...	Homo sapiens
AAB60340	99.9	ATP:citrate lya...	Homo sapiens
XP_001495696	98.6	ATP citrate lya...	Equus caballus
Q2TCH3	98.2	ATP-citrate syn...	Ovis aries

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003781	528	637	PF02629	CoA-binding
HMMPfam	IPR005811	678	823	PF00549	ATP-citrate lyase/succinyl-CoA ligase
ScanRegExp	IPR005809	309	333	PS01217	Succinyl-CoA synthetase
	IPR005810	697	726	PS01216	Succinyl-CoA ligase
	IPR005810	782	798	PS00399	Succinyl-CoA ligase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp