Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01004
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01004
Clone name hk04457
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TUBGCP3
cDNA sequence DNA sequence (3857 bp)
Predicted protein sequence (957 aa)
Flexi ORF Clone FXC01004
Description Gamma-tubulin complex component 3 (GCP-3) (Spindle pole body protein Spc98 homolog) (hSpc98) (hGCP3) (h104p).
Features of the cloned cDNA sequence

Length: 3857 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 981 bp
Genome contig ID gi51511729r_112087327
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
GTGAAAATTTAGAAAATTAAAAGCAATTATCTTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATGCATTCGTTATTTCTTGAGTAGTTTATGAAGGGACAGTTTACTTGC

Features of the protein sequence

Length: 957 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96CW5 0 100.0 Gamma-tubulin c...
Homo sapiens
CAA05832 0 99.7 unnamed protein...
Homo sapiens
XP_001142565 0 99.7 spindle pole bo...
Pan troglodytes
XP_534189 0 93.4 similar to Gamm...
Canis lupus fam...
P58854 0 93.6 Gamma-tubulin c...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007259 300 785 PF04130 Spc97/Spc98
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp