Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01012
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01012
Clone name ej01168
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PARP1
cDNA sequence DNA sequence (3623 bp)
Predicted protein sequence (1016 aa)
Flexi ORF Clone FXC01012
Description Poly [ADP-ribose] polymerase 1 (EC 2.4.2.30) (PARP-1) (ADPRT) (NAD(+) ADP-ribosyltransferase 1) (Poly[ADP-ribose] synthetase 1).
Features of the cloned cDNA sequence

Length: 3623 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 456 bp
Genome contig ID gi89161185r_224515328
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
TATTTTTAGTTAAAAATAAAAACTAATTTCATACT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATTTAGATTTTCTTTTTTATCTTGCACTTATTGTCCCCTTTTTAGTTTTT

Features of the protein sequence

Length: 1016 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10250 0 100.0 poly [ADP-ribos...
 synthetic construct
P09874 0 99.9 Poly [ADP-ribos...
 Homo sapiens
AAA60137 0 99.8 poly(ADP-ribose...
 Homo sapiens
AAH37545 0 99.8 Poly (ADP-ribos...
 Homo sapiens
ABM82562 0 99.7 poly (ADP-ribos...
 synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001510 4 89 PD004675 Zinc finger
IPR001510 115 199 PD004675 Zinc finger
HMMPfam IPR001510 14 92 PF00645 Zinc finger
IPR001510 118 202 PF00645 Zinc finger
IPR012982 281 334 PF08063 PADR1
IPR001357 387 465 PF00533 BRCT
IPR008893 550 635 PF05406 WGR
IPR004102 664 797 PF02877 Poly(ADP-ribose) polymerase
IPR001290 799 1009 PF00644 Poly(ADP-ribose) polymerase
HMMSmart IPR001357 389 468 SM00292 BRCT
IPR008893 555 635 SM00773 WGR
ProfileScan IPR001510 11 95 PS50064 Zinc finger
IPR001510 115 205 PS50064 Zinc finger
IPR001357 387 463 PS50172 BRCT
IPR004102 664 781 PS51060 Poly(ADP-ribose) polymerase
IPR012317 790 1016 PS51059 PARP
ScanRegExp IPR001510 23 58 PS00347 Zinc finger
IPR001510 127 164 PS00347 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp