ORK01028

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01028

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01028
Clone name	hm00142
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARHGAP12
cDNA sequence	DNA sequence (3957 bp) Predicted protein sequence (794 aa)
HaloTag ORF Clone	FHC01028
Flexi ORF Clone	FXC01028
Description	Rho GTPase-activating protein 12.

Features of the cloned cDNA sequence

Description

Length: 3957 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1347 bp
Genome contig ID	gi89161187r_32035245
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTACATGAAATGTCTAATAAAACTATAAGAGGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGATTTTTCCATTGGAAATGTGCATTTTGGTTTCTAATTTTTTTGTTT

Features of the protein sequence

Description

Length: 794 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI12373	100.0	Rho GTPase acti...	Homo sapiens
AAI15363	99.3	ARHGAP12 protei...	Homo sapiens
CAD38926	99.7	hypothetical pr...	Homo sapiens
XP_001084566	98.4	similar to Rho ...	Macaca mulatta
XP_001139895	98.1	Rho GTPase acti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001452	15	72	PF00018	Src homology-3
	IPR001202	267	296	PF00397	WW/Rsp5/WWP
	IPR001202	313	342	PF00397	WW/Rsp5/WWP
	IPR001849	412	523	PF00169	Pleckstrin-like
	IPR000198	618	770	PF00620	RhoGAP
HMMSmart	IPR001452	15	73	SM00326	Src homology-3
	IPR001202	266	298	SM00456	WW/Rsp5/WWP
	IPR001202	312	344	SM00456	WW/Rsp5/WWP
	IPR001849	412	525	SM00233	Pleckstrin-like
	IPR000198	615	789	SM00324	RhoGAP
ProfileScan	IPR001452	12	74	PS50002	Src homology-3
	IPR001202	265	298	PS50020	WW/Rsp5/WWP
	IPR001202	311	344	PS50020	WW/Rsp5/WWP
	IPR001849	411	523	PS50003	Pleckstrin-like
	IPR000198	604	792	PS50238	RhoGAP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp