ORK01124

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01124

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01124
Clone name	ee07548
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MICAL3
cDNA sequence	DNA sequence (8968 bp) Predicted protein sequence (1920 aa)
Flexi ORF Clone	FXC01124
Description	Protein MICAL-3.

Features of the cloned cDNA sequence

Description

Length: 8968 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3079 bp
Genome contig ID	gi89161203r_16550418
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGGTCTGTTTTATGCAAAATAAAAGTTTTTCAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATAGTGTGTTTCTTAAGTCATTTTACTGTATTTTTCAGGTGGATGGTG

Features of the protein sequence

Description

Length: 1920 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10388	100.0	MICAL-3 protein...	synthetic construct
EDK99652	76.3	microtubule ass...	Mus musculus
XP_001516246	75.2	similar to Em:A...	Ornithorhynchus...
NP_001116203	97.6	microtubule ass...	Homo sapiens
CAG30250	99.7	Em:AC016026.2 [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	766	820	PD000094	Zinc finger
FPrintScan	IPR003042	90	112	PR00420	Aromatic-ring hydroxylase
FPrintScan	IPR003042	217	232	PR00420	Aromatic-ring hydroxylase
HMMPfam	IPR002938	88	126	PF01494	Monooxygenase
	IPR001715	521	626	PF00307	Calponin-like actin-binding
	IPR001781	766	825	PF00412	Zinc finger
HMMSmart	IPR001715	522	621	SM00033	Calponin-like actin-binding
HMMSmart	IPR001781	765	819	SM00132	Zinc finger
ProfileScan	IPR001715	520	623	PS50021	Calponin-like actin-binding
ProfileScan	IPR001781	764	826	PS50023	Zinc finger
ScanRegExp	IPR001781	766	800	PS00478	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp