Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01190
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210001
Product ID ORK01190
Clone name ff03440
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol APC
cDNA sequence DNA sequence (10619 bp)
Predicted protein sequence (2845 aa)
Flexi ORF Clone FXC01190
Description Adenomatous polyposis coli protein (Protein APC).
Features of the cloned cDNA sequence

Length: 10619 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1930 bp
Genome contig ID gi51511721f_112001948
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
GCTAAAATGCCAGTAAATAAAAGTGCTATGACTTG
Flanking genome sequence
(207706 - 207755)		 
----+----*----+----*----+----*----+----*----+----*
AGCTAAGATATTTGACTCCAATGCCTGTACTGTGTCTACTGCACCACTTT

Features of the protein sequence

Length: 2845 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06083 0 100.0 APC variant pro...
 Homo sapiens
P25054 0 100.0 Adenomatous pol...
 Homo sapiens
AAA03586 0 99.9 APC [Homo sapiens].
 Homo sapiens
AAA60353 0 99.4 polyposis locus...
 Homo sapiens
XP_001143509 0 99.4 adenomatosis po...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000225 514 555 PF00514 Armadillo
IPR000225 558 599 PF00514 Armadillo
IPR000225 651 691 PF00514 Armadillo
IPR000225 693 733 PF00514 Armadillo
IPR009240 1022 1037 PF05972 APC 15 residue
IPR009240 1138 1153 PF05972 APC 15 residue
IPR009240 1157 1172 PF05972 APC 15 residue
IPR009240 1174 1189 PF05972 APC 15 residue
IPR009223 1258 1283 PF05923 APC cysteine-rich
IPR009223 1371 1396 PF05923 APC cysteine-rich
IPR009223 1487 1512 PF05923 APC cysteine-rich
IPR009224 1570 1591 PF05924 SAMP
IPR009223 1638 1663 PF05923 APC cysteine-rich
IPR009224 1720 1740 PF05924 SAMP
IPR009223 1842 1868 PF05923 APC cysteine-rich
IPR009223 1950 1975 PF05923 APC cysteine-rich
IPR009223 2008 2033 PF05923 APC cysteine-rich
IPR009224 2035 2055 PF05924 SAMP
IPR009234 2222 2581 PF05956 APC basic
IPR009232 2672 2845 PF05937 EB-1 binding
HMMSmart IPR000225 342 394 SM00185 Armadillo
IPR000225 461 512 SM00185 Armadillo
IPR000225 514 555 SM00185 Armadillo
IPR000225 558 599 SM00185 Armadillo
IPR000225 601 646 SM00185 Armadillo
IPR000225 651 691 SM00185 Armadillo
IPR000225 693 733 SM00185 Armadillo
ProfileScan IPR000225 662 704 PS50176 Armadillo
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp