Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01191
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01191
Clone name fh22665
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FAM13B
cDNA sequence DNA sequence (5043 bp)
Predicted protein sequence (925 aa)
Flexi ORF Clone FXC01191
Description Uncharacterized protein C5orf5 (GAP-like protein N61).
Features of the cloned cDNA sequence

Length: 5043 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2263 bp
Genome contig ID gi51511721r_137201550
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TACAGACTTTTATAATAAAAGAACTTGAAAGTTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTCATTGTAAATGTATGTTTGTTTTTCCACTGGGCTTAAAAAAAAAAA

Features of the protein sequence

Length: 925 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NYF5 0 100.0 Protein FAM13B;...
Homo sapiens
ACE87468 0 99.8 chromosome 5 op...
synthetic construct
BAG36896 0 99.8 unnamed protein...
Homo sapiens
AAF63764 0 99.8 GAP-like protei...
Homo sapiens
XP_517949 0 99.5 chromosome 5 op...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000198 49 200 PF00620 RhoGAP
HMMSmart IPR000198 46 219 SM00324 RhoGAP
ProfileScan IPR000198 33 222 PS50238 RhoGAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp